Review





Similar Products

94
OriGene green fluorescent protein fusion
Green Fluorescent Protein Fusion, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-EF1a-C-mGFP+Lentiviral+Gene+Expression+Vector/pm42271190-47-26-29
Average 94 stars, based on 1 article reviews
green fluorescent protein fusion - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

94
OriGene length wildtype pdgfra cdna
Length Wildtype Pdgfra Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-IRES-Neo+Lentiviral+Gene+Expression+Vector/10__1158_slash_2767___9764__crc___26___0093-94-13-9
Average 94 stars, based on 1 article reviews
length wildtype pdgfra cdna - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

96
OriGene plenti c myc ddk p2apuro
Plenti C Myc Ddk P2apuro, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-P2A-Puro+Lentiviral+Gene+Expression+Vector/pm42251161-372-14-15
Average 96 stars, based on 1 article reviews
plenti c myc ddk p2apuro - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
OriGene vector control
Vector Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-P2A-Puro+Lentiviral+Gene+Expression+Vector/bio_rxiv__64898__2026__05__14__725155-259-12-14
Average 96 stars, based on 1 article reviews
vector control - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

95
OriGene plenti c mgfp pp2a puro plasmid
Plenti C Mgfp Pp2a Puro Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-mGFP-P2A-Puro+Lentiviral+Gene+Expression+Vector/bio_rxiv__64898__2026__05__11__724294-205-1-16
Average 95 stars, based on 1 article reviews
plenti c mgfp pp2a puro plasmid - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

94
OriGene lentiviral vectors expressing shpolk
( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual <t>shPOLK</t> lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .
Lentiviral Vectors Expressing Shpolk, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/Polk+Mouse+shRNA+Lentiviral+Particle/pmc13171111-412-7-14
Average 94 stars, based on 1 article reviews
lentiviral vectors expressing shpolk - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

94
OriGene reporter gene
( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual <t>shPOLK</t> lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .
Reporter Gene, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-GFP+Lentiviral+Gene+Expression+Vector/pmc13167113-258-14-22
Average 94 stars, based on 1 article reviews
reporter gene - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

95
OriGene lentiviral vector
( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual <t>shPOLK</t> lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .
Lentiviral Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-IRES-Puro+Lentiviral+Gene+Expression+Vector/pmc13161366-426-25-27
Average 95 stars, based on 1 article reviews
lentiviral vector - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

96
OriGene plenti etfdh c myc ddk p2a puro
( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual <t>shPOLK</t> lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .
Plenti Etfdh C Myc Ddk P2a Puro, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-P2A-Puro+Lentiviral+Gene+Expression+Vector/pmc13143275-350-30-24
Average 96 stars, based on 1 article reviews
plenti etfdh c myc ddk p2a puro - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

94
OriGene irs4 wt
( A ) Violin plots of gene dependency for n = 1077 cell lines (DepMap) for genes targeted by FDA-approved targeted therapies (blue) or chemotherapies (red). Genes inhibited by multiprotein-targeted inhibitors were excluded. Individual cell lines (points) are shown when ≤−1.0 (not shown when median gene dependency ≤−0.5). ( B ) Box plot of median dependencies for 17,453 genes, separated into FDA-approved classes (A) or other genes. P values, two-sided Wilcoxon rank-sum test. n.s., not significant. ( C ) Box plot of z -scores for the GPD ξ value for each gene’s dependency distribution as a measure of selective dependency. Genes above the top quartile of the targeted therapy group (1.98%; n = 346) were selected for further analysis. ( D ) Workflow to identify pHTI genes using selective dependency (C), human and mouse genetics, and normal tissue (GTEx) expression. ( E ) Box plot of <t>IRS4</t> dependency scores by cancer type. ( F ) Correlation between IRS4 mRNA (CCLE RNA-seq) and dependency scores. r , Pearson correlation. ( G ) Western blot of indicated cell lines. ( H ) Western blot 3 days posttransduction with control or gene-targeted lentiviral sgRNAs at 10 MOI (for combination, each sgRNA at 5 MOI). Puromycin began 1 day posttransduction. ( I to L ) Viability (CellTiter-Glo) after lentiviral transduction in IRS4-absent (I and K) and IRS4-expressing (J and L) cell lines. Cells were transduced at 10 MOI (TC797, PER-624, G401, and HCC2429) or 20 MOI (all others), puromycin selected for 1 or 2 days, and plated with six technical replicates per time point (or three for PER-704). Eight to 14 hours after plating at day 0, measurement was performed for normalization. For TC797, PER-624, G401, and HCC2429, a combination of two IRS4 or PLK1 sgRNAs was given; puromycin was maintained during days 0 to 3 for each of these, except G401. For other cell lines, sgRNAs were administered individually without puromycin maintenance postplating. Points, mean values; errors bars, standard deviation.
Irs4 Wt, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lentiviral+expression+vector/pLenti-C-Myc-DDK-P2A-Puro-mGFP+Lentiviral+Gene+Expression+Vector/pmc13127590-231-10-19
Average 94 stars, based on 1 article reviews
irs4 wt - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

Image Search Results


( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual shPOLK lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .

Journal: eLife

Article Title: An altered cell-specific subcellular distribution of translesion synthesis DNA polymerase kappa (POLK) in aging mouse neurons

doi: 10.7554/eLife.101533

Figure Lengend Snippet: ( A ) Protein sequence alignment of mouse and human POLK, with the 133–310 amino acid epitope for sc-166667 anti-POLK antibody showing complete homology between species. ( B ) qPCR of Polk transcript shows a 35% reduction upon siRNA against Polk but not scrambled control siRNA. Polh mRNA levels were not affected by siRNA against Polk. ( C ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse primary cortical neurons treated with four individual shPOLK lentivirus, shows a decrease in 99 and 120 kDa POLK bands upon treatment with shPOLK#C. ( D ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of two biological replicates of mouse Neuro-2A cells treated with either siPOLK or shPOLK lentivirus, showed a decrease in 99 kDa POLK band. ( E ) Western blot immunostained with SC-166667 antiPOLK-HRP antibody of whole cell lysates of three biological replicates of mouse 4T1 cells treated with siPOLK showed a decrease in 99 and 120 kDa POLK bands. ( F ) Immunofluorescence staining of wild-type 18-month-old mouse, from brain cortical area S1 shows a similar pattern and distribution of POLK nuclear speckles (arrowheads) and cytoplasmic granules (arrows) using sc-166667 and A12052. The bottom row is a crop of the boxed area in the corresponding top image. ( G ) Full western blot showing all six replicates nucleus and cytoplasmic fractions from 7- and 22-month-old whole brain unsorted cells. Quantitation of the 99 kDa POLK band did not show an increase, possibly due to inability to extract POLK associated with lysosomal and stress granules (as observed in ). ( H ) Representative low (×20) and high magnification (×63) images of REV1 and POLI expression using IF from S1 and M1 cortical regions in ages 1, 10, and 18 months. REV1 (green) and Nissl depicting all cells (purple) (scale bar = 10 µm in ×20 image). Arrowheads point to nuclear speckles and arrows indicate cytoplasmic granules. Wild-type mouse brain cortical areas S1 and M1 show REV1 and POLI punctate nuclear expression resembling speckles and progressive cytoplasmic accumulation with age at 10 and 18 months. Figure 1—figure supplement 1—source data 1. Annotated original blots corresponding to . Figure 1—figure supplement 1—source data 2. Raw scans of original blots to .

Article Snippet: In addition, N2a cells were transduced with lentiviral vectors expressing shPolk (Cat No. TL502663V, Origene, which have four unique 29mer target-specific shRNAs sequences are 5′ → 3′′, TL502663VA: AGCCATGCCAGGATTTATTGCTAAGAGGC , TL502663VB: CCAGGATTTATTGCTAAGAGGCTCTGCC , TL502663VC: AATCGCAGCAAAGAGGAATGTCCTGATAT , TL502663VD: GGAGCTGCTAAGGACAGAAGTTAATGTGG ) or scrambled shRNA (Cat No. TR30021V, Origene, sequences are 5′ → 3′′ GCACTACCAGAGCTAACTCAGATAGTACT ) for 8 hr, followed by replacement with complete media.

Techniques: Sequencing, Control, Western Blot, Immunofluorescence, Staining, Quantitation Assay, Expressing

( A ) Violin plots of gene dependency for n = 1077 cell lines (DepMap) for genes targeted by FDA-approved targeted therapies (blue) or chemotherapies (red). Genes inhibited by multiprotein-targeted inhibitors were excluded. Individual cell lines (points) are shown when ≤−1.0 (not shown when median gene dependency ≤−0.5). ( B ) Box plot of median dependencies for 17,453 genes, separated into FDA-approved classes (A) or other genes. P values, two-sided Wilcoxon rank-sum test. n.s., not significant. ( C ) Box plot of z -scores for the GPD ξ value for each gene’s dependency distribution as a measure of selective dependency. Genes above the top quartile of the targeted therapy group (1.98%; n = 346) were selected for further analysis. ( D ) Workflow to identify pHTI genes using selective dependency (C), human and mouse genetics, and normal tissue (GTEx) expression. ( E ) Box plot of IRS4 dependency scores by cancer type. ( F ) Correlation between IRS4 mRNA (CCLE RNA-seq) and dependency scores. r , Pearson correlation. ( G ) Western blot of indicated cell lines. ( H ) Western blot 3 days posttransduction with control or gene-targeted lentiviral sgRNAs at 10 MOI (for combination, each sgRNA at 5 MOI). Puromycin began 1 day posttransduction. ( I to L ) Viability (CellTiter-Glo) after lentiviral transduction in IRS4-absent (I and K) and IRS4-expressing (J and L) cell lines. Cells were transduced at 10 MOI (TC797, PER-624, G401, and HCC2429) or 20 MOI (all others), puromycin selected for 1 or 2 days, and plated with six technical replicates per time point (or three for PER-704). Eight to 14 hours after plating at day 0, measurement was performed for normalization. For TC797, PER-624, G401, and HCC2429, a combination of two IRS4 or PLK1 sgRNAs was given; puromycin was maintained during days 0 to 3 for each of these, except G401. For other cell lines, sgRNAs were administered individually without puromycin maintenance postplating. Points, mean values; errors bars, standard deviation.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) Violin plots of gene dependency for n = 1077 cell lines (DepMap) for genes targeted by FDA-approved targeted therapies (blue) or chemotherapies (red). Genes inhibited by multiprotein-targeted inhibitors were excluded. Individual cell lines (points) are shown when ≤−1.0 (not shown when median gene dependency ≤−0.5). ( B ) Box plot of median dependencies for 17,453 genes, separated into FDA-approved classes (A) or other genes. P values, two-sided Wilcoxon rank-sum test. n.s., not significant. ( C ) Box plot of z -scores for the GPD ξ value for each gene’s dependency distribution as a measure of selective dependency. Genes above the top quartile of the targeted therapy group (1.98%; n = 346) were selected for further analysis. ( D ) Workflow to identify pHTI genes using selective dependency (C), human and mouse genetics, and normal tissue (GTEx) expression. ( E ) Box plot of IRS4 dependency scores by cancer type. ( F ) Correlation between IRS4 mRNA (CCLE RNA-seq) and dependency scores. r , Pearson correlation. ( G ) Western blot of indicated cell lines. ( H ) Western blot 3 days posttransduction with control or gene-targeted lentiviral sgRNAs at 10 MOI (for combination, each sgRNA at 5 MOI). Puromycin began 1 day posttransduction. ( I to L ) Viability (CellTiter-Glo) after lentiviral transduction in IRS4-absent (I and K) and IRS4-expressing (J and L) cell lines. Cells were transduced at 10 MOI (TC797, PER-624, G401, and HCC2429) or 20 MOI (all others), puromycin selected for 1 or 2 days, and plated with six technical replicates per time point (or three for PER-704). Eight to 14 hours after plating at day 0, measurement was performed for normalization. For TC797, PER-624, G401, and HCC2429, a combination of two IRS4 or PLK1 sgRNAs was given; puromycin was maintained during days 0 to 3 for each of these, except G401. For other cell lines, sgRNAs were administered individually without puromycin maintenance postplating. Points, mean values; errors bars, standard deviation.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: Expressing, RNA Sequencing, Western Blot, Control, Transduction, Standard Deviation

( A ) Top: Schematic of FKBP12 F36V (dTAG) knockin location at the C terminus of endogenous IRS4 in TTC1240 cells (heterozygous knockin was performed). Bottom: Diagram showing resulting IRS4 protein with a tag enabling the recruitment of VHL upon treatment with dTAG V -1, resulting in IRS4 degradation. a.a., amino acid. ( B ) Western blot after treatment of indicated cells with dTAG V -1 for 15 hours. ( C ) Proliferation assay comparing TTC1240 parental and TTC1240 IRS4-dTAG knockin cells’ proliferation using CellTiter-Glo (six technical replicates per time point). Points represent mean values; errors bars, standard deviation. The P value is by a two-sided t test. ( D ) Dose-response assay in TTC1240 parental and IRS4-dTAG cells treated with indicated doses of dTAG V -1 for 4 days using CellTiter-Glo. Points represent the means, and error bars represent the standard deviation. ( E ) Western blot of TTC1240 IRS4-dTAG knockin cells treated with an indicated number of hours (h) with dTAG V -1 (0.5 μM) or DMSO for 2.5 hours. The bottom IRS4 blot shows longer exposure. ( F ) Time-course proliferation assay of TTC1240 IRS4-dTAG knockin cells treated with 0.5 μM dTAG V -1 or DMSO control. The P value is by a two-sided t test.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) Top: Schematic of FKBP12 F36V (dTAG) knockin location at the C terminus of endogenous IRS4 in TTC1240 cells (heterozygous knockin was performed). Bottom: Diagram showing resulting IRS4 protein with a tag enabling the recruitment of VHL upon treatment with dTAG V -1, resulting in IRS4 degradation. a.a., amino acid. ( B ) Western blot after treatment of indicated cells with dTAG V -1 for 15 hours. ( C ) Proliferation assay comparing TTC1240 parental and TTC1240 IRS4-dTAG knockin cells’ proliferation using CellTiter-Glo (six technical replicates per time point). Points represent mean values; errors bars, standard deviation. The P value is by a two-sided t test. ( D ) Dose-response assay in TTC1240 parental and IRS4-dTAG cells treated with indicated doses of dTAG V -1 for 4 days using CellTiter-Glo. Points represent the means, and error bars represent the standard deviation. ( E ) Western blot of TTC1240 IRS4-dTAG knockin cells treated with an indicated number of hours (h) with dTAG V -1 (0.5 μM) or DMSO for 2.5 hours. The bottom IRS4 blot shows longer exposure. ( F ) Time-course proliferation assay of TTC1240 IRS4-dTAG knockin cells treated with 0.5 μM dTAG V -1 or DMSO control. The P value is by a two-sided t test.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: Knock-In, Western Blot, Proliferation Assay, Standard Deviation, Control

( A ) Scheme showing how HCC2429 (IRS4-expressing) or PER-624 (IRS4-absent) NUT midline cells were transduced with either control sgRNA (sgCtrl at 10 MOI) or a combination of IRS4 sgRNA #1 and sgRNA #2 (at 5 MOI for 10 MOI total). For each cell line, 3 days later, the two sgRNA populations were mixed at a 1:1 ratio and injected into flanks of mice (with an aliquot of cells saved for sgRNA quantification from genomic DNA). Xenografts grew for 10 to 15 days, as shown in ( B ), followed by harvesting of tumors and genomic DNA isolation for sgRNA quantification. ( C ) Relative abundance of the two IRS4 sgRNAs in PER-624 (orange) and HCC2429 (blue) xenografts 10 or 15 days after injection. Each point represents one tumor in a separate mouse. The y axis represents the percentage of the day 0 (pre-injection) percentage for each sgRNA. For example, a day 0 percentage of 25% decreasing to 20% on day 10 would represent 80% (20 of 25) of day 0. P values are by a two-sided t test.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) Scheme showing how HCC2429 (IRS4-expressing) or PER-624 (IRS4-absent) NUT midline cells were transduced with either control sgRNA (sgCtrl at 10 MOI) or a combination of IRS4 sgRNA #1 and sgRNA #2 (at 5 MOI for 10 MOI total). For each cell line, 3 days later, the two sgRNA populations were mixed at a 1:1 ratio and injected into flanks of mice (with an aliquot of cells saved for sgRNA quantification from genomic DNA). Xenografts grew for 10 to 15 days, as shown in ( B ), followed by harvesting of tumors and genomic DNA isolation for sgRNA quantification. ( C ) Relative abundance of the two IRS4 sgRNAs in PER-624 (orange) and HCC2429 (blue) xenografts 10 or 15 days after injection. Each point represents one tumor in a separate mouse. The y axis represents the percentage of the day 0 (pre-injection) percentage for each sgRNA. For example, a day 0 percentage of 25% decreasing to 20% on day 10 would represent 80% (20 of 25) of day 0. P values are by a two-sided t test.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: Expressing, Transduction, Control, Injection, DNA Extraction

( A ) IRS4 mRNA by RNA-seq using TCGA, St. Jude Cloud, and other datasets. TCGA abbreviations are used. All data represent patient tumors except NUT midline (cell lines). Top: % samples with IRS4 ≥40 TPM. Red, samples with an IRS4 genomic alteration based on WGS; blue, samples lacking such alterations; the legend applies to samples with ≥40 TPM. ( B ) Top: Locations of IRS4 DNA rearrangements in IRS4 -expressing cancers from (A). Circles, rearrangement breakpoints; arrows, direction of retained content. Figure S7 details three rearrangements outside the window shown. Partner chromosome genes are indicated with arrows. Bottom: Circos plot of these IRS4 rearrangements; each connection represents one sample, except two thicker lines representing recurrent alterations. * TCF12-IRS4 in DMS114. ( C ) Genomic locations of IRS4 rearrangements on partner chromosomes (circles). Dark arrows, direction of retained DNA. ( D ) Expression of rearrangement partners. Filled circles, samples with IRS4 rearrangements; adjacent text, percentile of the gene’s expression. ( E ) Oncoprint of IRS4 alterations in IRS4 -expressing tumors from (A) with WGS. * TCF12-IRS4 . Right: Cell lines. ( F ) Hi-C of TCF12-IRS4 –bearing DMS114 cells [t(15;X)]. Bottom: Zoomed-in view. H3K27ac ( GSE115124 ) and ATAC-seq data (this study) are shown. x axis, chrX around IRS4 ; y axis, chr15 around TCF12 . Red color, number of reads spanning the chr15-chrX interaction for each bin. Dotted lines, TCF12-IRS4 breakpoint. ( G ) Transcriptional clustering of malignant rhabdoid tumors (TARGET). IRS4 expression is overlaid in color. ( H ) ATAC-seq data in indicated cell lines or (bottom) available TCGA data. Left: IRS4 expression by RNA-seq. Scales differ for cell lines (CCLE) versus TCGA breast cancers. Circle, GATA3-IRS4 rearrangement location. ( I ) Left: Western blot after 48 hours of treatment with indicated compounds [1 μM for all except JQ1 (0.5 μM)]. Right: RNA-seq after 48 hours of 0.5 μM JQ1. ( J ) Western blot (left) or RNA-seq (right) after indicated transductions.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) IRS4 mRNA by RNA-seq using TCGA, St. Jude Cloud, and other datasets. TCGA abbreviations are used. All data represent patient tumors except NUT midline (cell lines). Top: % samples with IRS4 ≥40 TPM. Red, samples with an IRS4 genomic alteration based on WGS; blue, samples lacking such alterations; the legend applies to samples with ≥40 TPM. ( B ) Top: Locations of IRS4 DNA rearrangements in IRS4 -expressing cancers from (A). Circles, rearrangement breakpoints; arrows, direction of retained content. Figure S7 details three rearrangements outside the window shown. Partner chromosome genes are indicated with arrows. Bottom: Circos plot of these IRS4 rearrangements; each connection represents one sample, except two thicker lines representing recurrent alterations. * TCF12-IRS4 in DMS114. ( C ) Genomic locations of IRS4 rearrangements on partner chromosomes (circles). Dark arrows, direction of retained DNA. ( D ) Expression of rearrangement partners. Filled circles, samples with IRS4 rearrangements; adjacent text, percentile of the gene’s expression. ( E ) Oncoprint of IRS4 alterations in IRS4 -expressing tumors from (A) with WGS. * TCF12-IRS4 . Right: Cell lines. ( F ) Hi-C of TCF12-IRS4 –bearing DMS114 cells [t(15;X)]. Bottom: Zoomed-in view. H3K27ac ( GSE115124 ) and ATAC-seq data (this study) are shown. x axis, chrX around IRS4 ; y axis, chr15 around TCF12 . Red color, number of reads spanning the chr15-chrX interaction for each bin. Dotted lines, TCF12-IRS4 breakpoint. ( G ) Transcriptional clustering of malignant rhabdoid tumors (TARGET). IRS4 expression is overlaid in color. ( H ) ATAC-seq data in indicated cell lines or (bottom) available TCGA data. Left: IRS4 expression by RNA-seq. Scales differ for cell lines (CCLE) versus TCGA breast cancers. Circle, GATA3-IRS4 rearrangement location. ( I ) Left: Western blot after 48 hours of treatment with indicated compounds [1 μM for all except JQ1 (0.5 μM)]. Right: RNA-seq after 48 hours of 0.5 μM JQ1. ( J ) Western blot (left) or RNA-seq (right) after indicated transductions.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: RNA Sequencing, Expressing, Hi-C, Western Blot

( A ) IP-MS after IP of endogenous IRS4 from TTC709 or HCC2429 cells using an α-IRS4 or IgG control antibody. The x axis indicates the log fold change in protein abundance in α-IRS4 minus α-IgG IP. The y axis indicates the −log 10 P value ( G test) in protein abundance between these two conditions. Proteins with P < 1.0 × 10 −7 are highlighted. ( B ) Western blot performed 3 days after transducing TTC1240 cells with 10 MOI lentivirus of indicated IRS4 sgRNA or control sgRNA. When two IRS4 sgRNAs were used together, each individual sgRNA was used at 5 MOI. ( C ) Western blot of HCC2429 cells 4 days after transfection with indicated siRNAs, where transfection occurred twice on days 0 and 2. ( D ) Western blot of indicated cell lines after 3 hours of treatment with the PI3K inhibitor GDC-0941 at the indicated dose. ( E ) Cells were stably transduced with myristoylated Akt (Myr-Akt) or vector control (Western blot at the right), followed by transduction with 30 MOI sgCtrl lentivirus or sgIRS4 (15 MOI each of sgIRS4 #1 and sgIRS4 #2). Higher MOI was used because puromycin selection was not possible after CRISPR transduction because of puromycin selection already being used for Myr-Akt. Three days posttransduction, cells were plated for the proliferation assay time course. CellTiter-Glo was used to measure viability at each time point, and values were normalized to day 0 (as 100%). Points represent the means, and error bars represent the standard deviation. P values are by a two-sided t test. ( F ) Mutual exclusivity analysis between IRS4-absent and IRS4-expressing (≥40 TPM) TCGA breast cancers, analyzing the proportion of samples with somatic alterations in any one of the indicated PI3K pathway genes between the two groups by two-sided Fisher’s exact test. For samples with alterations in multiple PI3K genes, the sample is only shown for the bottom-most gene in the legend.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) IP-MS after IP of endogenous IRS4 from TTC709 or HCC2429 cells using an α-IRS4 or IgG control antibody. The x axis indicates the log fold change in protein abundance in α-IRS4 minus α-IgG IP. The y axis indicates the −log 10 P value ( G test) in protein abundance between these two conditions. Proteins with P < 1.0 × 10 −7 are highlighted. ( B ) Western blot performed 3 days after transducing TTC1240 cells with 10 MOI lentivirus of indicated IRS4 sgRNA or control sgRNA. When two IRS4 sgRNAs were used together, each individual sgRNA was used at 5 MOI. ( C ) Western blot of HCC2429 cells 4 days after transfection with indicated siRNAs, where transfection occurred twice on days 0 and 2. ( D ) Western blot of indicated cell lines after 3 hours of treatment with the PI3K inhibitor GDC-0941 at the indicated dose. ( E ) Cells were stably transduced with myristoylated Akt (Myr-Akt) or vector control (Western blot at the right), followed by transduction with 30 MOI sgCtrl lentivirus or sgIRS4 (15 MOI each of sgIRS4 #1 and sgIRS4 #2). Higher MOI was used because puromycin selection was not possible after CRISPR transduction because of puromycin selection already being used for Myr-Akt. Three days posttransduction, cells were plated for the proliferation assay time course. CellTiter-Glo was used to measure viability at each time point, and values were normalized to day 0 (as 100%). Points represent the means, and error bars represent the standard deviation. P values are by a two-sided t test. ( F ) Mutual exclusivity analysis between IRS4-absent and IRS4-expressing (≥40 TPM) TCGA breast cancers, analyzing the proportion of samples with somatic alterations in any one of the indicated PI3K pathway genes between the two groups by two-sided Fisher’s exact test. For samples with alterations in multiple PI3K genes, the sample is only shown for the bottom-most gene in the legend.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: Protein-Protein interactions, Control, Quantitative Proteomics, Western Blot, Transfection, Stable Transfection, Transduction, Plasmid Preparation, Selection, CRISPR, Proliferation Assay, Standard Deviation, Expressing

( A ) Diagram of IRS family protein signaling based largely on IRS1 and IRS2 studies. PH, PTB, and tail represent IRS4 domains. Red “P”, phosphotyrosine. The bottom shows the structure of the IRS1 PH and PTB domains (1QQG), with a small-molecule binding pocket indicated. ( B ) Left: IRS4 domain variants with deleted regions shown as absent or dotted lines. Right: Western blot of BT474 cells transduced with IRS4 domain variants (C-terminally FLAG tagged). The IRS4 antibody binding location is indicated. ( C ) MTT assay after 4 days of lapatinib treatment in BT474 or SKBR3 cells expressing indicated domain variants (performed in two batches; fig. S18). ( D ) Western blot of BT474 cells expressing indicated domain variants after 4 hours of lapatinib treatment. “Short” and “long” indicate exposure times. ( E ) Top: siRNA binding locations in IRS4 mRNA, indicating domain variants affected. HCC2429 cells were transduced with indicated IRS4 domain variants, followed by siRNA transfection. Proliferation was measured by the MTT assay (middle) 4 days after transfection (which occurred on days 0 and 2), and Western blotting (bottom) was performed 3 days after transfection. The bar plot shows the means and standard deviation of 10 technical replicates, which are shown as individual points. P values, two-sided t test. ( F ) CellTiter-Glo assay in TTC1240 IRS4-dTAG knockin cells after 4 days of dTAG V -1 treatment, after transduction with indicated IRS4 domain variants. Means and standard deviations are shown. ( G ) IP-Western blot of BT474 cells transduced as indicated. IP was performed using an α-IRS4 antibody (binding to the IRS4 C terminus) or IgG control. Left three lanes show input protein. ( H ) BT474 cells were stably transduced with GFP, IRS4 WT-GFP, or IRS4 ΔPH/PTB-GFP (latter two with GFP as a C-terminal tag). Cells were stained with NucRed Live 647, and live cell imaging was then performed using a Zeiss Apotome microscope.

Journal: Science Advances

Article Title: IRS4 is a PI3K-activating cancer dependency up-regulated through DNA rearrangements or epigenetic mechanisms in multiple solid tumors

doi: 10.1126/sciadv.aeb3503

Figure Lengend Snippet: ( A ) Diagram of IRS family protein signaling based largely on IRS1 and IRS2 studies. PH, PTB, and tail represent IRS4 domains. Red “P”, phosphotyrosine. The bottom shows the structure of the IRS1 PH and PTB domains (1QQG), with a small-molecule binding pocket indicated. ( B ) Left: IRS4 domain variants with deleted regions shown as absent or dotted lines. Right: Western blot of BT474 cells transduced with IRS4 domain variants (C-terminally FLAG tagged). The IRS4 antibody binding location is indicated. ( C ) MTT assay after 4 days of lapatinib treatment in BT474 or SKBR3 cells expressing indicated domain variants (performed in two batches; fig. S18). ( D ) Western blot of BT474 cells expressing indicated domain variants after 4 hours of lapatinib treatment. “Short” and “long” indicate exposure times. ( E ) Top: siRNA binding locations in IRS4 mRNA, indicating domain variants affected. HCC2429 cells were transduced with indicated IRS4 domain variants, followed by siRNA transfection. Proliferation was measured by the MTT assay (middle) 4 days after transfection (which occurred on days 0 and 2), and Western blotting (bottom) was performed 3 days after transfection. The bar plot shows the means and standard deviation of 10 technical replicates, which are shown as individual points. P values, two-sided t test. ( F ) CellTiter-Glo assay in TTC1240 IRS4-dTAG knockin cells after 4 days of dTAG V -1 treatment, after transduction with indicated IRS4 domain variants. Means and standard deviations are shown. ( G ) IP-Western blot of BT474 cells transduced as indicated. IP was performed using an α-IRS4 antibody (binding to the IRS4 C terminus) or IgG control. Left three lanes show input protein. ( H ) BT474 cells were stably transduced with GFP, IRS4 WT-GFP, or IRS4 ΔPH/PTB-GFP (latter two with GFP as a C-terminal tag). Cells were stained with NucRed Live 647, and live cell imaging was then performed using a Zeiss Apotome microscope.

Article Snippet: Cells were transduced with GFP control (pLenti-C-Myc-DDK-P2A-Puro-mGFP, catalog ps100123) or IRS4 WT [pLenti-C-Myc-DDK-P2A-Puro-IRS4 ( NM_003604 ), catalog RC218385L3] from Origene or IRS4 with the following regions deleted: amino acids 374 to 668 (ΔTail-1), amino acids 669 to 963 (ΔTail-2), amino acids 964 to 1257 (ΔTail-3),amino acids 2 to 227 (ΔPH), amino acids 228 to 373 (ΔPTB), or amino acids 2 to 373 (ΔPH/PTB).

Techniques: Binding Assay, Western Blot, Transduction, MTT Assay, Expressing, Transfection, Standard Deviation, Glo Assay, Knock-In, Control, Stable Transfection, Staining, Live Cell Imaging, Microscopy